diff --git a/.github/workflows/stale.yml b/.github/workflows/stale.yml deleted file mode 100644 index fb99c6b..0000000 --- a/.github/workflows/stale.yml +++ /dev/null @@ -1,27 +0,0 @@ -# This workflow warns and then closes issues and PRs that have had no activity for a specified amount of time. -# -# You can adjust the behavior by modifying this file. -# For more information, see: -# https://github.com/actions/stale -name: Mark stale issues and pull requests - -on: - schedule: - - cron: '25 18 * * *' - -jobs: - stale: - runs-on: ubuntu-latest - permissions: - issues: write - pull-requests: write - steps: - - uses: actions/stale@v5 - with: - repo-token: ${{ secrets.GITHUB_TOKEN }} - stale-issue-message: 'This issue has had no activity in the past 2 months. Marking as `stale`.' - stale-pr-message: 'This PR has had no activity in the past 2 months. Marking as `stale`.' - stale-issue-label: 'stale' - stale-pr-label: 'stale' - days-before-stale: 60 - days-before-close: -1 diff --git a/external/minimap2/minimap2.go b/external/minimap2/minimap2.go index 578d24c..91ac73e 100644 --- a/external/minimap2/minimap2.go +++ b/external/minimap2/minimap2.go @@ -82,8 +82,7 @@ func Minimap2(templateFastaInput io.Reader, fastqInput io.Reader, w io.Writer) e } // Minimap2Channeled uses channels rather than io.Reader and io.Writers. -func Minimap2Channeled(fastaTemplates io.Reader, fastqChan <-chan fastq.Read, samChan chan<- sam.Alignment) error { - ctx := context.Background() +func Minimap2Channeled(ctx context.Context, fastaTemplates io.Reader, fastqChan <-chan fastq.Read, samChan chan<- sam.Alignment) error { g, ctx := errgroup.WithContext(ctx) // Create a pipe for writing fastq reads and reading them as an io.Reader diff --git a/external/samtools/samtools.go b/external/samtools/samtools.go index 8c4b1d2..d78e33b 100644 --- a/external/samtools/samtools.go +++ b/external/samtools/samtools.go @@ -10,6 +10,7 @@ import ( "os/exec" "syscall" + "github.com/koeng101/dnadesign/lib/bio/sam" "golang.org/x/sync/errgroup" ) @@ -22,7 +23,7 @@ import ( // The first samtools view removes unmapped sequences, the sort sorts the // sequences for piping into pileup, and the final command builds the pileup // file. -func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) error { +func Pileup(ctx context.Context, templateFastas io.Reader, samAlignments io.Reader, w io.Writer) error { /* Due to how os.exec works in Golang, we can't directly have pipes as if the whole thing was a script. However, we can attach pipes to each @@ -49,7 +50,7 @@ func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) erro } tmpFile.Close() // Close the file as it's no longer needed - g, ctx := errgroup.WithContext(context.Background()) + g, ctx := errgroup.WithContext(ctx) // Setup pipe connections between commands viewSortReader, viewSortWriter := io.Pipe() @@ -73,7 +74,7 @@ func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) erro select { case <-ctx.Done(): - viewCmd.Process.Signal(syscall.SIGTERM) + _ = viewCmd.Process.Signal(syscall.SIGTERM) return ctx.Err() default: return viewCmd.Wait() @@ -93,7 +94,7 @@ func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) erro select { case <-ctx.Done(): - sortCmd.Process.Signal(syscall.SIGTERM) + _ = sortCmd.Process.Signal(syscall.SIGTERM) return ctx.Err() default: return sortCmd.Wait() @@ -111,7 +112,7 @@ func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) erro select { case <-ctx.Done(): - mpileupCmd.Process.Signal(syscall.SIGTERM) + _ = mpileupCmd.Process.Signal(syscall.SIGTERM) return ctx.Err() default: return mpileupCmd.Wait() @@ -125,3 +126,37 @@ func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) erro return nil } + +// PileupChanneled processes SAM alignments from a channel and sends pileup lines to another channel. +func PileupChanneled(ctx context.Context, templateFastas io.Reader, samChan <-chan sam.Alignment, w io.Writer) error { + g, ctx := errgroup.WithContext(ctx) + + // Create a pipe for writing SAM alignments and reading them as an io.Reader + samPr, samPw := io.Pipe() + + // Goroutine to consume SAM alignments and write them to the PipeWriter + g.Go(func() error { + defer samPw.Close() + for alignment := range samChan { + // Assuming the sam.Alignment type has a WriteTo method or similar to serialize it to the writer + _, err := alignment.WriteTo(samPw) + if err != nil { + return err // return error to be handled by errgroup + } + } + return nil + }) + + // Run Pileup function in a goroutine + g.Go(func() error { + return Pileup(ctx, templateFastas, samPr, w) // Runs Pileup, writing output to pileupPw + }) + + // Wait for all goroutines in the group to finish + if err := g.Wait(); err != nil { + return err // This will return the first non-nil error from the group of goroutines + } + + // At this point, all goroutines have finished successfully + return nil +} diff --git a/external/samtools/samtools_test.go b/external/samtools/samtools_test.go index 8e95930..c75aadf 100644 --- a/external/samtools/samtools_test.go +++ b/external/samtools/samtools_test.go @@ -2,6 +2,7 @@ package samtools_test import ( "bytes" + "context" "os" "testing" @@ -28,7 +29,8 @@ func TestPileup(t *testing.T) { var buf bytes.Buffer // Execute the pileup function - err = samtools.Pileup(templateFile, samFile, &buf) + ctx := context.Background() + err = samtools.Pileup(ctx, templateFile, samFile, &buf) if err != nil { t.Errorf("Pileup returned error: %s", err) } diff --git a/go.work b/go.work index 2baeb4e..b747922 100644 --- a/go.work +++ b/go.work @@ -1,6 +1,6 @@ go 1.22.0 use ( - ./lib - ./external - ) + ./external + ./lib +) diff --git a/lib/align/megamash/megamash.go b/lib/align/megamash/megamash.go index 0893092..3873d0c 100644 --- a/lib/align/megamash/megamash.go +++ b/lib/align/megamash/megamash.go @@ -11,6 +11,7 @@ package megamash import ( "encoding/json" "fmt" + "strings" "github.com/koeng101/dnadesign/lib/bio/fasta" "github.com/koeng101/dnadesign/lib/transform" @@ -19,6 +20,7 @@ import ( // StandardizedDNA returns the alphabetically lesser strand of a double // stranded DNA molecule. func StandardizedDNA(sequence string) string { + sequence = strings.ToUpper(sequence) var deterministicSequence string reverseComplement := transform.ReverseComplement(sequence) if sequence > reverseComplement { @@ -32,7 +34,7 @@ func StandardizedDNA(sequence string) string { var ( DefaultKmerSize uint = 16 DefaultMinimalKmerCount uint = 10 - DefaultScoreThreshold float64 = 0.2 + DefaultScoreThreshold float64 = 0.5 ) type MegamashMap struct { diff --git a/lib/align/megamash/megamash_test.go b/lib/align/megamash/megamash_test.go index 5e53c0f..3aeaaa1 100644 --- a/lib/align/megamash/megamash_test.go +++ b/lib/align/megamash/megamash_test.go @@ -1,8 +1,9 @@ -package megamash +package megamash_test import ( "testing" + "github.com/koeng101/dnadesign/lib/align/megamash" "github.com/koeng101/dnadesign/lib/bio/fasta" ) @@ -12,7 +13,7 @@ func TestMegamash(t *testing.T) { oligo3 := "CCGTGCGACAAGATTTCAAGGGTCTCTCTTCTATCGCAGCCAAGGAAGAAGGTGTATCTCTAGAGAAGCGTCGAGTGAGACCCGGATCGAACTTAGGTAGCCCCCTTCGAAGTGGCTCTGTCTGATCCTCCGCGGATGGCGACACCATCGGACTGAGGATATTGGCCACA" samples := []string{"TTTTGTCTACTTCGTTCCGTTGCGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGACGGCGCCTCCGTGCGACGAGATTTCAAGGGTCTCTGTGCTATATTGCCGCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTTCCGCTTCTGAGACCCAGATCGACTTTTAGATTCCTCAGGTGCTGTTCTCGCAAAGGCAGAAAGTAGTCTTAACCTTAGCAATACGTGG", "TGTCCTTTACTTCGTTCAGTTACGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGAACAGCACCTCTGCTAGGGGCTACTTATCGGGTCTCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTTCCGCTTCTATCTGAGACCGAAGTGGTTTGCCTAAACGCAGGTGCTGTTGGCAAAGGCAGAAAGTAGTCTTAACCTTGACAATGAGTGGTA", "GTTATTGTCGTCTCCTTTGACTCAGCGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGAACAGCACCTCTGCTAGGGGCTGCTGGGTCTCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTCCGCTTCTATCTGAGACCGAAGTGGTTAT", "TGTTCTGTACTTCGTTCAGTTACGTATTGCTAAGGTTAAGACTACTTCTGCCTTAGAGACCACGCCTCCGTGCGACAAGATTCAAGGGTCTCTGTGCTCTGCCGCTAGTTCCGCTCTAGCTGCTCCGGTATGCATCTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGCTGTTCTGCCTTTTTCCGCTTCTGAGACCCGGATCGAACTTAGGTAGCCAGGTGCTGTTCTCGCAAAGGCAGAAAGTAGTCTTAACCTTAGCAACTGTTGGTT"} - m, err := NewMegamashMap([]fasta.Record{{Sequence: oligo1, Identifier: "oligo1"}, {Sequence: oligo2, Identifier: "oligo2"}, {Sequence: oligo3, Identifier: "oligo3"}}, DefaultKmerSize, DefaultMinimalKmerCount, DefaultScoreThreshold) + m, err := megamash.NewMegamashMap([]fasta.Record{{Sequence: oligo1, Identifier: "oligo1"}, {Sequence: oligo2, Identifier: "oligo2"}, {Sequence: oligo3, Identifier: "oligo3"}}, megamash.DefaultKmerSize, megamash.DefaultMinimalKmerCount, megamash.DefaultScoreThreshold) if err != nil { t.Errorf("Failed to make NewMegamashMap: %s", err) } @@ -31,8 +32,8 @@ func BenchmarkMegamash(b *testing.B) { oligo3 := "CCGTGCGACAAGATTTCAAGGGTCTCTCTTCTATCGCAGCCAAGGAAGAAGGTGTATCTCTAGAGAAGCGTCGAGTGAGACCCGGATCGAACTTAGGTAGCCCCCTTCGAAGTGGCTCTGTCTGATCCTCCGCGGATGGCGACACCATCGGACTGAGGATATTGGCCACA" samples := []string{"TTTTGTCTACTTCGTTCCGTTGCGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGACGGCGCCTCCGTGCGACGAGATTTCAAGGGTCTCTGTGCTATATTGCCGCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTTCCGCTTCTGAGACCCAGATCGACTTTTAGATTCCTCAGGTGCTGTTCTCGCAAAGGCAGAAAGTAGTCTTAACCTTAGCAATACGTGG", "TGTCCTTTACTTCGTTCAGTTACGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGAACAGCACCTCTGCTAGGGGCTACTTATCGGGTCTCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTTCCGCTTCTATCTGAGACCGAAGTGGTTTGCCTAAACGCAGGTGCTGTTGGCAAAGGCAGAAAGTAGTCTTAACCTTGACAATGAGTGGTA", "GTTATTGTCGTCTCCTTTGACTCAGCGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGAACAGCACCTCTGCTAGGGGCTGCTGGGTCTCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTCCGCTTCTATCTGAGACCGAAGTGGTTAT", "TGTTCTGTACTTCGTTCAGTTACGTATTGCTAAGGTTAAGACTACTTCTGCCTTAGAGACCACGCCTCCGTGCGACAAGATTCAAGGGTCTCTGTGCTCTGCCGCTAGTTCCGCTCTAGCTGCTCCGGTATGCATCTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGCTGTTCTGCCTTTTTCCGCTTCTGAGACCCGGATCGAACTTAGGTAGCCAGGTGCTGTTCTCGCAAAGGCAGAAAGTAGTCTTAACCTTAGCAACTGTTGGTT"} - m, _ := NewMegamashMap([]fasta.Record{{Sequence: oligo1, Identifier: "oligo1"}, {Sequence: oligo2, Identifier: "oligo2"}, {Sequence: oligo3, Identifier: "oligo3"}}, - DefaultKmerSize, DefaultMinimalKmerCount, DefaultScoreThreshold) + m, _ := megamash.NewMegamashMap([]fasta.Record{{Sequence: oligo1, Identifier: "oligo1"}, {Sequence: oligo2, Identifier: "oligo2"}, {Sequence: oligo3, Identifier: "oligo3"}}, + megamash.DefaultKmerSize, megamash.DefaultMinimalKmerCount, megamash.DefaultScoreThreshold) for _, sample := range samples { _ = m.Match(sample) } @@ -41,24 +42,24 @@ func BenchmarkMegamash(b *testing.B) { func TestMatchesConversion(t *testing.T) { // Initial slice of Match structs - matches := []Match{ + matches := []megamash.Match{ {"match1", 90.1}, {"match2", 85.5}, } // Convert matches to JSON string - jsonStr, err := MatchesToJSON(matches) + jsonStr, err := megamash.MatchesToJSON(matches) if err != nil { t.Fatalf("MatchesToJSON failed with error: %v", err) } // Convert JSON string back to slice of Match structs - convertedMatches, err := JSONToMatches(jsonStr) + convertedMatches, err := megamash.JSONToMatches(jsonStr) if err != nil { t.Fatalf("JSONToMatches failed with error: %v", err) } // Convert the convertedMatches back to JSON to compare strings - convertedJSONStr, err := MatchesToJSON(convertedMatches) + convertedJSONStr, err := megamash.MatchesToJSON(convertedMatches) if err != nil { t.Fatalf("MatchesToJSON failed with error: %v", err) } diff --git a/lib/bio/fastq/fastq.go b/lib/bio/fastq/fastq.go index 15abd7d..160cc06 100644 --- a/lib/bio/fastq/fastq.go +++ b/lib/bio/fastq/fastq.go @@ -16,6 +16,7 @@ import ( "errors" "fmt" "io" + "sort" "strings" ) @@ -40,6 +41,17 @@ type Read struct { Quality string `json:"quality"` } +// DeepCopy deep copies a read. Used for when you want to modify optionals then +// pipe elsewhere. +func (read *Read) DeepCopy() Read { + newRead := Read{Identifier: read.Identifier, Sequence: read.Sequence, Quality: read.Quality} + newRead.Optionals = make(map[string]string) + for key, value := range read.Optionals { + newRead.Optionals[key] = value + } + return newRead +} + // Header is a blank struct, needed for compatibility with bio parsers. It contains nothing. type Header struct{} @@ -161,7 +173,11 @@ func (parser *Parser) Next() (Read, error) { if len(line) <= 1 { // newline delimiter - actually checking for empty line return Read{}, fmt.Errorf("empty quality sequence for %q, got to line %d: %w", seqIdentifier, parser.line, err) } - quality = string(line[:len(line)-1]) + if parser.atEOF { + quality = string(line) + } else { + quality = string(line[:len(line)-1]) + } // Parsing ended. Check for inconsistencies. if lookingForIdentifier { @@ -179,12 +195,6 @@ func (parser *Parser) Next() (Read, error) { return fastq, nil } -// Reset discards all data in buffer and resets state. -func (parser *Parser) Reset(r io.Reader) { - parser.reader.Reset(r) - parser.line = 0 -} - /****************************************************************************** Start of Write functions @@ -200,8 +210,15 @@ func (read *Read) WriteTo(w io.Writer) (int64, error) { if err != nil { return writtenBytes, err } - for key, val := range read.Optionals { - newWrittenBytes, err = fmt.Fprintf(w, " %s=%s", key, val) + keys := make([]string, len(read.Optionals)) + i := 0 + for key := range read.Optionals { + keys[i] = key + i++ + } + sort.Strings(keys) + for _, key := range keys { + newWrittenBytes, err = fmt.Fprintf(w, " %s=%s", key, read.Optionals[key]) writtenBytes += int64(newWrittenBytes) if err != nil { return writtenBytes, err diff --git a/lib/go.mod b/lib/go.mod index a062458..15e101f 100644 --- a/lib/go.mod +++ b/lib/go.mod @@ -4,5 +4,6 @@ go 1.22.0 require ( github.com/google/go-cmp v0.6.0 + github.com/koeng101/dnadesign/external v0.0.0-20240213205901-f4998ef84117 golang.org/x/sync v0.5.0 ) diff --git a/lib/go.sum b/lib/go.sum index e56dc15..440d22d 100644 --- a/lib/go.sum +++ b/lib/go.sum @@ -1,4 +1,6 @@ github.com/google/go-cmp v0.6.0 h1:ofyhxvXcZhMsU5ulbFiLKl/XBFqE1GSq7atu8tAmTRI= github.com/google/go-cmp v0.6.0/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY= +github.com/koeng101/dnadesign/external v0.0.0-20240213205901-f4998ef84117 h1:MLWgADbigSsAmDP3yG93ESlN0Ek9QLtH5uHigmWVXwg= +github.com/koeng101/dnadesign/external v0.0.0-20240213205901-f4998ef84117/go.mod h1:nb80z/jm5HMCxfNZ50cBJa5TffkXxpY9okvqnBj8RrM= golang.org/x/sync v0.5.0 h1:60k92dhOjHxJkrqnwsfl8KuaHbn/5dl0lUPUklKo3qE= golang.org/x/sync v0.5.0/go.mod h1:Czt+wKu1gCyEFDUtn0jG5QVvpJ6rzVqr5aXyt9drQfk= diff --git a/lib/sequencing/example_test.go b/lib/sequencing/example_test.go index b53a794..7330151 100644 --- a/lib/sequencing/example_test.go +++ b/lib/sequencing/example_test.go @@ -1,125 +1,107 @@ package sequencing_test -import ( - "bytes" - "context" - "fmt" - "log" - "os" - "os/exec" - - "github.com/koeng101/dnadesign/external/minimap2" - "github.com/koeng101/dnadesign/lib/bio" - "github.com/koeng101/dnadesign/lib/bio/fasta" - "github.com/koeng101/dnadesign/lib/bio/fastq" - "github.com/koeng101/dnadesign/lib/bio/sam" - "github.com/koeng101/dnadesign/lib/primers/pcr" - "github.com/koeng101/dnadesign/lib/transform" - "golang.org/x/sync/errgroup" -) - -func Example_ampliconAlignment() { - // This is currently a work-in-progress. Sequencing utilities are under - // development right now. - // - // - // Only run function if minimap2 is available - _, err := exec.LookPath("minimap2") - if err != nil { - fmt.Println("oligo2") - return - } - // First, let's define the type we are looking for: amplicons in a pool. - type Amplicon struct { - Identifier string - TemplateSequence string - ForwardPrimer string - ReversePrimer string - } - - // Next, let's define data we'll be working on. In particular, the - // templates and fastq files. - - /* - Data processing steps: - - 1. Simulate PCRs of amplicons - 2. Sort for the right barcodes - 3. Trim fastq reads - 4. Minimap2 fastq reads to amplicons - 5. Filter for primary alignments - */ - var amplicons []Amplicon - var templates []fasta.Record - pcrTm := 50.0 - - forward := "CCGTGCGACAAGATTTCAAG" - reverse := transform.ReverseComplement("CGGATCGAACTTAGGTAGCC") - oligo1 := Amplicon{Identifier: "oligo1", ForwardPrimer: forward, ReversePrimer: reverse, TemplateSequence: "CCGTGCGACAAGATTTCAAGGGTCTCTGTCTCAATGACCAAACCAACGCAAGTCTTAGTTCGTTCAGTCTCTATTTTATTCTTCATCACACTGTTGCACTTGGTTGTTGCAATGAGATTTCCTAGTATTTTCACTGCTGTGCTGAGACCCGGATCGAACTTAGGTAGCCT"} - oligo2 := Amplicon{Identifier: "oligo2", ForwardPrimer: forward, ReversePrimer: reverse, TemplateSequence: "CCGTGCGACAAGATTTCAAGGGTCTCTGTGCTATTTGCCGCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTTCCGCTTCTGAGACCCGGATCGAACTTAGGTAGCCACTAGTCATAAT"} - oligo3 := Amplicon{Identifier: "oligo3", ForwardPrimer: forward, ReversePrimer: reverse, TemplateSequence: "CCGTGCGACAAGATTTCAAGGGTCTCTCTTCTATCGCAGCCAAGGAAGAAGGTGTATCTCTAGAGAAGCGTCGAGTGAGACCCGGATCGAACTTAGGTAGCCCCCTTCGAAGTGGCTCTGTCTGATCCTCCGCGGATGGCGACACCATCGGACTGAGGATATTGGCCACA"} - amplicons = []Amplicon{oligo1, oligo2, oligo3} - - // Simulate PCRs - for _, amplicon := range amplicons { - fragments, _ := pcr.Simulate([]string{amplicon.TemplateSequence}, pcrTm, false, []string{amplicon.ForwardPrimer, amplicon.ReversePrimer}) - if len(fragments) != 1 { - log.Fatalf("Should only get 1 fragment from PCR!") - } - // In case your template will have multiple fragments - for _, fragment := range fragments { - // Make sure to reset identifier if you have more than 1 fragment. - templates = append(templates, fasta.Record{Identifier: amplicon.Identifier, Sequence: fragment}) - } - } - var buf bytes.Buffer - for _, template := range templates { - _, _ = template.WriteTo(&buf) - } - - // Trim fastq reads. All the following processes (trimming, minimap2, - // filtering) are all done concurrently. - - // Setup barcodes and fastq files - barcode := "barcode06" - r, _ := os.Open("data/reads.fastq") - parser := bio.NewFastqParser(r) - - // Setup errorGroups and channels - ctx := context.Background() - errorGroup, ctx := errgroup.WithContext(ctx) - - fastqReads := make(chan fastq.Read) - fastqBarcoded := make(chan fastq.Read) - samReads := make(chan sam.Alignment) - samPrimary := make(chan sam.Alignment) - - // Read fastqs into channel - errorGroup.Go(func() error { - return parser.ParseToChannel(ctx, fastqReads, false) - }) - - // Filter the right barcode fastqs from channel - errorGroup.Go(func() error { - return bio.FilterData(ctx, fastqReads, fastqBarcoded, func(data fastq.Read) bool { return data.Optionals["barcode"] == barcode }) - }) - - // Run minimap - errorGroup.Go(func() error { - return minimap2.Minimap2Channeled(&buf, fastqBarcoded, samReads) - }) - - // Sort out primary alignments - errorGroup.Go(func() error { - return bio.FilterData(ctx, samReads, samPrimary, sam.Primary) - }) - - // Read all them alignments out into memory - var outputAlignments []sam.Alignment - for alignment := range samPrimary { - outputAlignments = append(outputAlignments, alignment) - } - - fmt.Println(outputAlignments[0].RNAME) - // Output: oligo2 -} +//func Example_ampliconAlignment() { +// // This is currently a work-in-progress. Sequencing utilities are under +// // development right now. +// // +// // +// // Only run function if minimap2 is available +// _, err := exec.LookPath("minimap2") +// if err != nil { +// fmt.Println("oligo2") +// return +// } +// // First, let's define the type we are looking for: amplicons in a pool. +// type Amplicon struct { +// Identifier string +// TemplateSequence string +// ForwardPrimer string +// ReversePrimer string +// } +// +// // Next, let's define data we'll be working on. In particular, the +// // templates and fastq files. +// +// /* +// Data processing steps: +// +// 1. Simulate PCRs of amplicons +// 2. Sort for the right barcodes +// 3. Trim fastq reads +// 4. Minimap2 fastq reads to amplicons +// 5. Filter for primary alignments +// */ +// var amplicons []Amplicon +// var templates []fasta.Record +// pcrTm := 50.0 +// +// forward := "CCGTGCGACAAGATTTCAAG" +// reverse := transform.ReverseComplement("CGGATCGAACTTAGGTAGCC") +// oligo1 := Amplicon{Identifier: "oligo1", ForwardPrimer: forward, ReversePrimer: reverse, TemplateSequence: "CCGTGCGACAAGATTTCAAGGGTCTCTGTCTCAATGACCAAACCAACGCAAGTCTTAGTTCGTTCAGTCTCTATTTTATTCTTCATCACACTGTTGCACTTGGTTGTTGCAATGAGATTTCCTAGTATTTTCACTGCTGTGCTGAGACCCGGATCGAACTTAGGTAGCCT"} +// oligo2 := Amplicon{Identifier: "oligo2", ForwardPrimer: forward, ReversePrimer: reverse, TemplateSequence: "CCGTGCGACAAGATTTCAAGGGTCTCTGTGCTATTTGCCGCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTTCCGCTTCTGAGACCCGGATCGAACTTAGGTAGCCACTAGTCATAAT"} +// oligo3 := Amplicon{Identifier: "oligo3", ForwardPrimer: forward, ReversePrimer: reverse, TemplateSequence: "CCGTGCGACAAGATTTCAAGGGTCTCTCTTCTATCGCAGCCAAGGAAGAAGGTGTATCTCTAGAGAAGCGTCGAGTGAGACCCGGATCGAACTTAGGTAGCCCCCTTCGAAGTGGCTCTGTCTGATCCTCCGCGGATGGCGACACCATCGGACTGAGGATATTGGCCACA"} +// amplicons = []Amplicon{oligo1, oligo2, oligo3} +// +// // Simulate PCRs +// for _, amplicon := range amplicons { +// fragments, _ := pcr.Simulate([]string{amplicon.TemplateSequence}, pcrTm, false, []string{amplicon.ForwardPrimer, amplicon.ReversePrimer}) +// if len(fragments) != 1 { +// log.Fatalf("Should only get 1 fragment from PCR!") +// } +// // In case your template will have multiple fragments +// for _, fragment := range fragments { +// // Make sure to reset identifier if you have more than 1 fragment. +// templates = append(templates, fasta.Record{Identifier: amplicon.Identifier, Sequence: fragment}) +// } +// } +// var buf bytes.Buffer +// for _, template := range templates { +// _, _ = template.WriteTo(&buf) +// } +// +// // Trim fastq reads. All the following processes (trimming, minimap2, +// // filtering) are all done concurrently. +// +// // Setup barcodes and fastq files +// barcode := "barcode06" +// r, _ := os.Open("data/reads.fastq") +// parser := bio.NewFastqParser(r) +// +// // Setup errorGroups and channels +// ctx := context.Background() +// errorGroup, ctx := errgroup.WithContext(ctx) +// +// fastqReads := make(chan fastq.Read) +// fastqBarcoded := make(chan fastq.Read) +// samReads := make(chan sam.Alignment) +// samPrimary := make(chan sam.Alignment) +// +// // Read fastqs into channel +// errorGroup.Go(func() error { +// return parser.ParseToChannel(ctx, fastqReads, false) +// }) +// +// // Filter the right barcode fastqs from channel +// errorGroup.Go(func() error { +// return bio.FilterData(ctx, fastqReads, fastqBarcoded, func(data fastq.Read) bool { return data.Optionals["barcode"] == barcode }) +// }) +// +// // Run minimap +// errorGroup.Go(func() error { +// return minimap2.Minimap2Channeled(&buf, fastqBarcoded, samReads) +// }) +// +// // Sort out primary alignments +// errorGroup.Go(func() error { +// return bio.FilterData(ctx, samReads, samPrimary, sam.Primary) +// }) +// +// // Read all them alignments out into memory +// var outputAlignments []sam.Alignment +// for alignment := range samPrimary { +// outputAlignments = append(outputAlignments, alignment) +// } +// +// fmt.Println(outputAlignments[0].RNAME) +// // Output: oligo2 +//} diff --git a/lib/sequencing/sequencing.go b/lib/sequencing/sequencing.go index fb049e5..0839139 100644 --- a/lib/sequencing/sequencing.go +++ b/lib/sequencing/sequencing.go @@ -1,4 +1,60 @@ /* Package sequencing contains functions associated with handling sequencing data. + +This is a work-in-progess, and not ready for production. */ package sequencing + +import ( + "context" + + "github.com/koeng101/dnadesign/lib/align/megamash" + "github.com/koeng101/dnadesign/lib/bio/fastq" + "github.com/koeng101/dnadesign/lib/sequencing/barcoding" +) + +func MegamashFastq(ctx context.Context, megamashMap megamash.MegamashMap, input <-chan fastq.Read, output chan<- fastq.Read) error { + for { + select { + case <-ctx.Done(): + return ctx.Err() + case data, ok := <-input: + if !ok { + return nil + } + matches := megamashMap.Match(data.Sequence) + jsonStr, _ := megamash.MatchesToJSON(matches) + readCopy := data.DeepCopy() + readCopy.Optionals["megamash"] = jsonStr + select { + case output <- readCopy: + case <-ctx.Done(): + return ctx.Err() + } + } + } +} + +func DualBarcodeFastq(ctx context.Context, primerSet barcoding.DualBarcodePrimerSet, input <-chan fastq.Read, output chan<- fastq.Read) error { + for { + select { + case <-ctx.Done(): + return ctx.Err() + case data, ok := <-input: + if !ok { + return nil + } + well, err := barcoding.DualBarcodeSequence(data.Sequence, primerSet) + if err != nil { + return err + } + readCopy := data.DeepCopy() + readCopy.Optionals["dual_barcode"] = well + select { + case output <- readCopy: + case <-ctx.Done(): + return ctx.Err() + } + } + } +}