From 0694d1d2473ec01935021dc61d913f6d514a164c Mon Sep 17 00:00:00 2001
From: Koeng101 <Koeng101@gmail.com>
Date: Tue, 24 Sep 2024 16:53:08 -0700
Subject: [PATCH] updateBuild (#99)

artifact v2 depreciated with github actions, so this updates to v4
---
 .github/workflows/build.yml | 4 ++--
 .github/workflows/docs.yml  | 2 +-
 py/tests/test_fragment.py   | 1 +
 3 files changed, 4 insertions(+), 3 deletions(-)

diff --git a/.github/workflows/build.yml b/.github/workflows/build.yml
index c6bb0ee..5c995ac 100644
--- a/.github/workflows/build.yml
+++ b/.github/workflows/build.yml
@@ -111,7 +111,7 @@ jobs:
         gdb -ex "run" -ex "bt full" -ex "quit" --args python -m pytest ./py/tests -v
 
     - name: Upload artifacts
-      uses: actions/upload-artifact@v2
+      uses: actions/upload-artifact@v4
       with:
         name: dist-${{ runner.os }}-${{ matrix.arch }}
         path: py/dist/
@@ -135,7 +135,7 @@ jobs:
         pip install twine
 
     - name: Download artifacts
-      uses: actions/download-artifact@v2
+      uses: actions/download-artifact@v4
       with:
         path: dist
 
diff --git a/.github/workflows/docs.yml b/.github/workflows/docs.yml
index f462a74..ee1c994 100644
--- a/.github/workflows/docs.yml
+++ b/.github/workflows/docs.yml
@@ -63,7 +63,7 @@ jobs:
         pdoc ./py/dnadesign -o ./docs
 
     - name: Upload artifact
-      uses: actions/upload-pages-artifact@v2
+      uses: actions/upload-pages-artifact@v4
       with:
         path: './docs'  # Adjust this to your build output directory
 
diff --git a/py/tests/test_fragment.py b/py/tests/test_fragment.py
index 0a7b203..38740e9 100644
--- a/py/tests/test_fragment.py
+++ b/py/tests/test_fragment.py
@@ -42,3 +42,4 @@ def test_recursive_fragment():
     result = recursive_fragment(gene, max_oligo_len, assembly_pattern, exclude_overhangs, default_overhangs)
     assert result is not None, "RecursiveFragment failed"
     # Add more specific assertions based on the expected structure of the result
+    assert result.fragments == ['ATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAG', 'CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAG']