updateBuild (#99)

artifact v2 depreciated with github actions, so this updates to v4
Koeng101 · Sep 24, 2024 · 0694d1d · 0694d1d
1 parent cf75dc9
commit 0694d1d
Show file tree

Hide file tree

Showing 3 changed files with 4 additions and 3 deletions.
diff --git a/.github/workflows/build.yml b/.github/workflows/build.yml
@@ -111,7 +111,7 @@ jobs:
         gdb -ex "run" -ex "bt full" -ex "quit" --args python -m pytest ./py/tests -v
 
     - name: Upload artifacts
-      uses: actions/upload-artifact@v2
+      uses: actions/upload-artifact@v4
       with:
         name: dist-${{ runner.os }}-${{ matrix.arch }}
         path: py/dist/
@@ -135,7 +135,7 @@ jobs:
         pip install twine
 
     - name: Download artifacts
-      uses: actions/download-artifact@v2
+      uses: actions/download-artifact@v4
       with:
         path: dist
 

diff --git a/.github/workflows/docs.yml b/.github/workflows/docs.yml
@@ -63,7 +63,7 @@ jobs:
         pdoc ./py/dnadesign -o ./docs
 
     - name: Upload artifact
-      uses: actions/upload-pages-artifact@v2
+      uses: actions/upload-pages-artifact@v4
       with:
         path: './docs'  # Adjust this to your build output directory
 

diff --git a/py/tests/test_fragment.py b/py/tests/test_fragment.py
@@ -42,3 +42,4 @@ def test_recursive_fragment():
     result = recursive_fragment(gene, max_oligo_len, assembly_pattern, exclude_overhangs, default_overhangs)
     assert result is not None, "RecursiveFragment failed"
     # Add more specific assertions based on the expected structure of the result
+    assert result.fragments == ['ATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAG', 'CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAG']