-
Notifications
You must be signed in to change notification settings - Fork 3
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
Showing
34 changed files
with
523 additions
and
37 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
|
@@ -11,3 +11,8 @@ testing* | |
venv/ | ||
params*.json | ||
sample_manifest* | ||
*.log | ||
tests/sample-data/* | ||
tests/ref/* | ||
!**/.gitkeep | ||
.nf-test/ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,8 @@ | ||
config { | ||
|
||
testsDir "tests" | ||
workDir System.getenv("NFT_WORKDIR") ?: ".nf-test" | ||
configFile "tests/nextflow.config" | ||
profile "singularity" | ||
|
||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,24 @@ | ||
# Test datasets and files | ||
|
||
end-to-end tests for the quants pipeline using the nf-test framework. | ||
|
||
Having retrieved data and placed it in the ref and sample-data folders, tests can be run with `nf-test test tests/test[#].main.nf.test` | ||
|
||
To confirm that you've retrieved the correct data, and named it appropriately if necessary, run `diff -q <(md5sum tests/sample-data/*) tests/sample-data-checksums` and `diff -q <(md5sum tests/ref/*) tests/ref-checksums`. If the commands return nothing (exit code 0), the data is as expected. Note that if you do not run this command from the top level directory of the repo, it will fail, as md5sum will output relative paths along with checksums. | ||
|
||
## Test parameters | ||
|
||
| Test | Source | FASTQ or CRAM | SE or PE| RevComp | Read merging | Adapter trimming | Primer Trimming | Read filtering | Read modification | QC | Quantification | | ||
| --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | | ||
| `test1.main.nf.test` | Trimmed | FASTQ | SE | Y | N | N | N | N | Y | N | Y | | ||
| `test2.main.nf.test` | Trimmed | FASTQ | SE | Y | N | N | N | N | Y | Y | Y | | ||
| `test3.main.nf.test` | Raw | FASTQ | SE | Y | N | Y | Y | N | Y | Y | Y | | ||
| `test4.main.nf.test` | Raw | CRAM | SE | Y | N | Y | Y | N | Y | Y | Y | | ||
| `test5.main.nf.test` | Raw | FASTQ | PE | N | Y (SeqPrep) | Y | Y | N | N | Y | Y | | ||
| `test6.main.nf.test` | Raw | FASTQ | PE | N | Y (Flash2) | Y | Y | Y | N | Y | Y | | ||
| `test7.main.nf.test` | Raw | FASTQ | PE | N | Y (SeqPrep) | Y | Y | Y | N | Y | Y | | ||
| `test8.main.nf.test` | Raw | FASTQ | PE | N | Y (Flash2) | Y | Y | Y | N | Y | Y | | ||
| `test9.main.nf.test` | Raw | FASTQ | PE | N | Y (Flash2) | Y | Y | Y | N | Y | Y | | ||
| `test10.main.nf.test` | Raw | FASTQ | SE | N | N | Y | Y | Y | N | Y | Y | | ||
| `test11.main.nf.test` | Raw | FASTQ | SE | N | N | Y | Y | N | Y | Y | Y | | ||
| `test12.main.nf.test` | Raw | CRAM | SE | N | N | Y | Y | N | Y | Y | Y | |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
sample,cram_file | ||
test_sample,../../../tests/sample-data/1.cram |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
sample,cram_file | ||
test_sample,../../../tests/sample-data/2.cram |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
sample,fastq_1,fastq_2 | ||
lib,../../../tests/sample-data/libR1.fq.gz,../../../tests/sample-data/libR2.fq.gz | ||
u,../../../tests/sample-data/uR1.fq.gz,../../../tests/sample-data/uR2.fq.gz | ||
v,../../../tests/sample-data/vR1.fq.gz,../../../tests/sample-data/vR2.fq.gz | ||
w,../../../tests/sample-data/wR1.fq.gz,../../../tests/sample-data/wR2.fq.gz |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
sample,fastq_1,fastq_2 | ||
test_sample,../../../tests/sample-data/xR1.fq.gz,../../../tests/sample-data/xR2.fq.gz |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
sample,fastq_1,fastq_2 | ||
HG_CH_1_4_A,/lustre/scratch125/casm/team78/quants_test_data/DATA/2.fq.gz, | ||
HG_CH_1_4_B,/lustre/scratch125/casm/team78/quants_test_data/DATA/3.fq.gz, | ||
HG_CH_1_4_C,/lustre/scratch125/casm/team78/quants_test_data/DATA/4.fq.gz, |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
sample,fastq_1,fastq_2 | ||
test_sample,../../../tests/sample-data/1.fq.gz, |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
sample,fastq_1,fastq_2 | ||
test_sample,../../../tests/sample-data/2.fq.gz, |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
sample,fastq_1,fastq_2 | ||
test_sample,../../../tests/sample-data/sge.fq.gz, |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
/* | ||
======================================================================================== | ||
Nextflow config file for running tests | ||
======================================================================================== | ||
*/ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
485b9de403b0278ed6684ad1348d37a8 tests/ref/1.csv | ||
3e403419a08708609c9341a07ef7ac98 tests/ref/2.csv | ||
e3c702dee536c45e8eeae36996fcd207 tests/ref/3.tsv | ||
ac0899f173efe28a5b4b9b161f232d93 tests/ref/4.tsv | ||
075cc1feb687db2c899a48fb263076a4 tests/ref/5.tsv |
Empty file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,17 @@ | ||
77d92378b88ed28dd3f7d5d580971a53 tests/sample-data/1.cram | ||
26d427131d4720aa7ed07e8018c526b1 tests/sample-data/1.fq.gz | ||
b822820791a9fb4fde3af96afa9308a5 tests/sample-data/2.cram | ||
023bc001077093ad6586a4c5f601ad37 tests/sample-data/2.fq.gz | ||
0d131b633a2af323b025a756ae933d7b tests/sample-data/3.fq.gz | ||
47201d8a28b69328823c8df973041ec2 tests/sample-data/4.fq.gz | ||
2ab872bb3f7de763c27d8811e3e2c622 tests/sample-data/libR1.fq.gz | ||
65888a8f410e81e0633a814dc77743e5 tests/sample-data/libR2.fq.gz | ||
5bf45c57e729d8629e99df3979d1c97c tests/sample-data/sge.fq.gz | ||
4da5792d1d6a5d998f0ace0870c55f29 tests/sample-data/uR1.fq.gz | ||
2ef7c9ad9eaf02f903fafd340095fbd5 tests/sample-data/uR2.fq.gz | ||
232f948fbbd7bd49f2cf9735c527a744 tests/sample-data/vR1.fq.gz | ||
5dce830523e9927aba8433ff79b56db4 tests/sample-data/vR2.fq.gz | ||
77ffaf4d0dcf665bd9ba31e8da885c16 tests/sample-data/wR1.fq.gz | ||
2777816cca4302e9c042dfaeb17d6dea tests/sample-data/wR2.fq.gz | ||
0aee12c4562d18eba0300ba0a144371a tests/sample-data/xR1.fq.gz | ||
6a789cedb3b9f64479ec6c875eceae1a tests/sample-data/xR2.fq.gz |
Empty file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,31 @@ | ||
nextflow_pipeline { | ||
|
||
name "Test Workflow main.nf" | ||
script "main.nf" | ||
|
||
test("Should run without failures") { | ||
|
||
when { | ||
params { | ||
input = "${projectDir}/tests/manifests/trimmed-fastq-se.csv" | ||
single_end = true | ||
input_type = "fastq" | ||
read_modification = true | ||
append_start = "ATTCACGTTATGCTGTCCAATCTCT" | ||
append_end = "GAAATCTAAAATTACCTTCCCAGGG" | ||
append_quality = "?" | ||
read_transform = "reverse_complement" | ||
transform_library = true | ||
pyquest_library_converter_options = "-N 1 -S 24" | ||
quantification = "pyquest" | ||
oligo_library = "${projectDir}/tests/ref/2.csv" | ||
} | ||
} | ||
|
||
then { | ||
assert workflow.success | ||
} | ||
|
||
} | ||
|
||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,30 @@ | ||
// TEST BROKEN | ||
nextflow_pipeline { | ||
|
||
name "Test Workflow main.nf" | ||
script "main.nf" | ||
|
||
test("Should run without failures") { | ||
|
||
when { | ||
params { | ||
input = "${projectDir}/tests/manifests/raw-fastq-se-multiple-samples.csv" | ||
single_end = true | ||
input_type = "fastq" | ||
raw_sequencing_qc = true | ||
adapter_trimming = "cutadapt" | ||
adapter_cutadapt_options = "-a 'AGATCGGAAGAGCGGTTCAGCAGGAATGCCG' -A 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT' -m 1" | ||
adapter_trimming_qc = true | ||
primer_trimming = "cutadapt" | ||
primer_cutadapt_options = "-g 'TCTACATTTTATTTGCACTACTTGAAGG...ATACTTTTAAGTTCTGGGGTCATGTG' -G 'CACATGACCCCAGAACTTAAA...AGTGCAAATAAAATGTAGA' -m 1" | ||
primer_trimming_qc = true | ||
} | ||
} | ||
|
||
then { | ||
assert workflow.success | ||
} | ||
|
||
} | ||
|
||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,37 @@ | ||
nextflow_pipeline { | ||
|
||
name "Test Workflow main.nf" | ||
script "main.nf" | ||
|
||
test("Should run without failures") { | ||
|
||
when { | ||
params { | ||
input = "${projectDir}/tests/manifests/raw-fastq-se-noRC.csv" | ||
single_end = true | ||
input_type = "fastq" | ||
raw_sequencing_qc = true | ||
adapter_trimming = "cutadapt" | ||
adapter_cutadapt_options = "-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -m 1" | ||
adapter_trimming_qc = true | ||
primer_trimming = "cutadapt" | ||
primer_cutadapt_options = "-g 'AGCATGTCTAAGGCATATCAGAGCA...TGAGCTGGCAGAGGGGCCATTGTGG' -m 1" | ||
primer_trimming_qc = true | ||
read_modification = true | ||
append_start = "AGCATGTCTAAGGCATATCAGAGCA" | ||
append_end = "TGAGCTGGCAGAGGGGCCATTGTGG" | ||
append_quality = "?" | ||
transform_library = true | ||
pyquest_library_converter_options = "-N 1 -S 24" | ||
quantification = "pyquest" | ||
oligo_library = "${projectDir}/tests/ref/1.csv" | ||
} | ||
} | ||
|
||
then { | ||
assert workflow.success | ||
} | ||
|
||
} | ||
|
||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,37 @@ | ||
nextflow_pipeline { | ||
|
||
name "Test Workflow main.nf" | ||
script "main.nf" | ||
|
||
test("Should run without failures") { | ||
|
||
when { | ||
params { | ||
input = "${projectDir}/tests/manifests/raw-cram-se-noRC.csv" | ||
single_end = true | ||
input_type = "cram" | ||
raw_sequencing_qc = true | ||
adapter_trimming = "cutadapt" | ||
adapter_cutadapt_options = "-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -m 1" | ||
adapter_trimming_qc = true | ||
primer_trimming = "cutadapt" | ||
primer_cutadapt_options = "-g 'AGCATGTCTAAGGCATATCAGAGCA...TGAGCTGGCAGAGGGGCCATTGTGG' -m 1" | ||
primer_trimming_qc = true | ||
read_modification = true | ||
append_start = "AGCATGTCTAAGGCATATCAGAGCA" | ||
append_end = "TGAGCTGGCAGAGGGGCCATTGTGG" | ||
append_quality = "?" | ||
transform_library = true | ||
pyquest_library_converter_options = "-N 1 -S 24" | ||
quantification = "pyquest" | ||
oligo_library = "${projectDir}/tests/ref/1.csv" | ||
} | ||
} | ||
|
||
then { | ||
assert workflow.success | ||
} | ||
|
||
} | ||
|
||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,30 @@ | ||
nextflow_pipeline { | ||
|
||
name "Test Workflow main.nf" | ||
script "main.nf" | ||
|
||
test("Should run without failures") { | ||
|
||
when { | ||
params { | ||
input = "${projectDir}/tests/manifests/trimmed-fastq-se.csv" | ||
single_end = true | ||
input_type = "fastq" | ||
raw_sequencing_qc = true | ||
read_modification = true | ||
append_start = "ATTCACGTTATGCTGTCCAATCTCT" | ||
append_end = "GAAATCTAAAATTACCTTCCCAGGG" | ||
append_quality = "?" | ||
read_transform = "reverse_complement" | ||
quantification = "pyquest" | ||
oligo_library = "${projectDir}/tests/ref/3.tsv" | ||
} | ||
} | ||
|
||
then { | ||
assert workflow.success | ||
} | ||
|
||
} | ||
|
||
} |
Oops, something went wrong.