indexing

external/minimap2/minimap2.go

@@ -82,8 +82,7 @@ func Minimap2(templateFastaInput io.Reader, fastqInput io.Reader, w io.Writer) e
 }
 
 // Minimap2Channeled uses channels rather than io.Reader and io.Writers.
-func Minimap2Channeled(fastaTemplates io.Reader, fastqChan <-chan fastq.Read, samChan chan<- sam.Alignment) error {
-	ctx := context.Background()
+func Minimap2Channeled(ctx context.Context, fastaTemplates io.Reader, fastqChan <-chan fastq.Read, samChan chan<- sam.Alignment) error {
 	g, ctx := errgroup.WithContext(ctx)
 
 	// Create a pipe for writing fastq reads and reading them as an io.Reader

external/samtools/samtools.go

@@ -10,6 +10,7 @@ import (
 	"os/exec"
 	"syscall"
 
+	"github.com/koeng101/dnadesign/lib/bio/sam"
 	"golang.org/x/sync/errgroup"
 )
 
@@ -22,7 +23,7 @@ import (
 // The first samtools view removes unmapped sequences, the sort sorts the
 // sequences for piping into pileup, and the final command builds the pileup
 // file.
-func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) error {
+func Pileup(ctx context.Context, templateFastas io.Reader, samAlignments io.Reader, w io.Writer) error {
 	/*
 		Due to how os.exec works in Golang, we can't directly have pipes as if
 		the whole thing was a script. However, we can attach pipes to each
@@ -49,7 +50,7 @@ func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) erro
 	}
 	tmpFile.Close() // Close the file as it's no longer needed
 
-	g, ctx := errgroup.WithContext(context.Background())
+	g, ctx := errgroup.WithContext(ctx)
 
 	// Setup pipe connections between commands
 	viewSortReader, viewSortWriter := io.Pipe()
@@ -73,7 +74,7 @@ func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) erro
 
 		select {
 		case <-ctx.Done():
-			viewCmd.Process.Signal(syscall.SIGTERM)
+			_ = viewCmd.Process.Signal(syscall.SIGTERM)
 			return ctx.Err()
 		default:
 			return viewCmd.Wait()
@@ -93,7 +94,7 @@ func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) erro
 
 		select {
 		case <-ctx.Done():
-			sortCmd.Process.Signal(syscall.SIGTERM)
+			_ = sortCmd.Process.Signal(syscall.SIGTERM)
 			return ctx.Err()
 		default:
 			return sortCmd.Wait()
@@ -111,7 +112,7 @@ func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) erro
 
 		select {
 		case <-ctx.Done():
-			mpileupCmd.Process.Signal(syscall.SIGTERM)
+			_ = mpileupCmd.Process.Signal(syscall.SIGTERM)
 			return ctx.Err()
 		default:
 			return mpileupCmd.Wait()
@@ -125,3 +126,37 @@ func Pileup(templateFastas io.Reader, samAlignments io.Reader, w io.Writer) erro
 
 	return nil
 }
+
+// PileupChanneled processes SAM alignments from a channel and sends pileup lines to another channel.
+func PileupChanneled(ctx context.Context, templateFastas io.Reader, samChan <-chan sam.Alignment, w io.Writer) error {
+	g, ctx := errgroup.WithContext(ctx)
+
+	// Create a pipe for writing SAM alignments and reading them as an io.Reader
+	samPr, samPw := io.Pipe()
+
+	// Goroutine to consume SAM alignments and write them to the PipeWriter
+	g.Go(func() error {
+		defer samPw.Close()
+		for alignment := range samChan {
+			// Assuming the sam.Alignment type has a WriteTo method or similar to serialize it to the writer
+			_, err := alignment.WriteTo(samPw)
+			if err != nil {
+				return err // return error to be handled by errgroup
+			}
+		}
+		return nil
+	})
+
+	// Run Pileup function in a goroutine
+	g.Go(func() error {
+		return Pileup(ctx, templateFastas, samPr, w) // Runs Pileup, writing output to pileupPw
+	})
+
+	// Wait for all goroutines in the group to finish
+	if err := g.Wait(); err != nil {
+		return err // This will return the first non-nil error from the group of goroutines
+	}
+
+	// At this point, all goroutines have finished successfully
+	return nil
+}

external/samtools/samtools_test.go

@@ -2,6 +2,7 @@ package samtools_test
 
 import (
 	"bytes"
+	"context"
 	"os"
 	"testing"
 
@@ -28,7 +29,8 @@ func TestPileup(t *testing.T) {
 	var buf bytes.Buffer
 
 	// Execute the pileup function
-	err = samtools.Pileup(templateFile, samFile, &buf)
+	ctx := context.Background()
+	err = samtools.Pileup(ctx, templateFile, samFile, &buf)
 	if err != nil {
 		t.Errorf("Pileup returned error: %s", err)
 	}

go.work

@@ -1,6 +1,6 @@
 go 1.22.0
 
 use (
-    ./lib
-    ./external
-    )
+	./external
+	./lib
+)

lib/align/megamash/megamash.go

@@ -11,6 +11,7 @@ package megamash
 import (
 	"encoding/json"
 	"fmt"
+	"strings"
 
 	"github.com/koeng101/dnadesign/lib/bio/fasta"
 	"github.com/koeng101/dnadesign/lib/transform"
@@ -19,6 +20,7 @@ import (
 // StandardizedDNA returns the alphabetically lesser strand of a double
 // stranded DNA molecule.
 func StandardizedDNA(sequence string) string {
+	sequence = strings.ToUpper(sequence)
 	var deterministicSequence string
 	reverseComplement := transform.ReverseComplement(sequence)
 	if sequence > reverseComplement {
@@ -32,7 +34,7 @@ func StandardizedDNA(sequence string) string {
 var (
 	DefaultKmerSize         uint    = 16
 	DefaultMinimalKmerCount uint    = 10
-	DefaultScoreThreshold   float64 = 0.2
+	DefaultScoreThreshold   float64 = 0.5
 )
 
 type MegamashMap struct {

lib/align/megamash/megamash_test.go

@@ -1,8 +1,9 @@
-package megamash
+package megamash_test
 
 import (
 	"testing"
 
+	"github.com/koeng101/dnadesign/lib/align/megamash"
 	"github.com/koeng101/dnadesign/lib/bio/fasta"
 )
 
@@ -12,7 +13,7 @@ func TestMegamash(t *testing.T) {
 	oligo3 := "CCGTGCGACAAGATTTCAAGGGTCTCTCTTCTATCGCAGCCAAGGAAGAAGGTGTATCTCTAGAGAAGCGTCGAGTGAGACCCGGATCGAACTTAGGTAGCCCCCTTCGAAGTGGCTCTGTCTGATCCTCCGCGGATGGCGACACCATCGGACTGAGGATATTGGCCACA"
 
 	samples := []string{"TTTTGTCTACTTCGTTCCGTTGCGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGACGGCGCCTCCGTGCGACGAGATTTCAAGGGTCTCTGTGCTATATTGCCGCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTTCCGCTTCTGAGACCCAGATCGACTTTTAGATTCCTCAGGTGCTGTTCTCGCAAAGGCAGAAAGTAGTCTTAACCTTAGCAATACGTGG", "TGTCCTTTACTTCGTTCAGTTACGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGAACAGCACCTCTGCTAGGGGCTACTTATCGGGTCTCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTTCCGCTTCTATCTGAGACCGAAGTGGTTTGCCTAAACGCAGGTGCTGTTGGCAAAGGCAGAAAGTAGTCTTAACCTTGACAATGAGTGGTA", "GTTATTGTCGTCTCCTTTGACTCAGCGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGAACAGCACCTCTGCTAGGGGCTGCTGGGTCTCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTCCGCTTCTATCTGAGACCGAAGTGGTTAT", "TGTTCTGTACTTCGTTCAGTTACGTATTGCTAAGGTTAAGACTACTTCTGCCTTAGAGACCACGCCTCCGTGCGACAAGATTCAAGGGTCTCTGTGCTCTGCCGCTAGTTCCGCTCTAGCTGCTCCGGTATGCATCTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGCTGTTCTGCCTTTTTCCGCTTCTGAGACCCGGATCGAACTTAGGTAGCCAGGTGCTGTTCTCGCAAAGGCAGAAAGTAGTCTTAACCTTAGCAACTGTTGGTT"}
-	m, err := NewMegamashMap([]fasta.Record{{Sequence: oligo1, Identifier: "oligo1"}, {Sequence: oligo2, Identifier: "oligo2"}, {Sequence: oligo3, Identifier: "oligo3"}}, DefaultKmerSize, DefaultMinimalKmerCount, DefaultScoreThreshold)
+	m, err := megamash.NewMegamashMap([]fasta.Record{{Sequence: oligo1, Identifier: "oligo1"}, {Sequence: oligo2, Identifier: "oligo2"}, {Sequence: oligo3, Identifier: "oligo3"}}, megamash.DefaultKmerSize, megamash.DefaultMinimalKmerCount, megamash.DefaultScoreThreshold)
 	if err != nil {
 		t.Errorf("Failed to make NewMegamashMap: %s", err)
 	}
@@ -31,8 +32,8 @@ func BenchmarkMegamash(b *testing.B) {
 		oligo3 := "CCGTGCGACAAGATTTCAAGGGTCTCTCTTCTATCGCAGCCAAGGAAGAAGGTGTATCTCTAGAGAAGCGTCGAGTGAGACCCGGATCGAACTTAGGTAGCCCCCTTCGAAGTGGCTCTGTCTGATCCTCCGCGGATGGCGACACCATCGGACTGAGGATATTGGCCACA"
 
 		samples := []string{"TTTTGTCTACTTCGTTCCGTTGCGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGACGGCGCCTCCGTGCGACGAGATTTCAAGGGTCTCTGTGCTATATTGCCGCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTTCCGCTTCTGAGACCCAGATCGACTTTTAGATTCCTCAGGTGCTGTTCTCGCAAAGGCAGAAAGTAGTCTTAACCTTAGCAATACGTGG", "TGTCCTTTACTTCGTTCAGTTACGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGAACAGCACCTCTGCTAGGGGCTACTTATCGGGTCTCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTTCCGCTTCTATCTGAGACCGAAGTGGTTTGCCTAAACGCAGGTGCTGTTGGCAAAGGCAGAAAGTAGTCTTAACCTTGACAATGAGTGGTA", "GTTATTGTCGTCTCCTTTGACTCAGCGTATTGCTAAGGTTAAGACTACTTTCTGCCTTTGCGAGAACAGCACCTCTGCTAGGGGCTGCTGGGTCTCTAGTTCCGCTCTAGCTGCTCCAGTTAATACTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGTTCTGCCTTTTCCGCTTCTATCTGAGACCGAAGTGGTTAT", "TGTTCTGTACTTCGTTCAGTTACGTATTGCTAAGGTTAAGACTACTTCTGCCTTAGAGACCACGCCTCCGTGCGACAAGATTCAAGGGTCTCTGTGCTCTGCCGCTAGTTCCGCTCTAGCTGCTCCGGTATGCATCTACTACTGAAGATGAATTGGAGGGTGACTTCGATGTTGCTGCTGTTCTGCCTTTTTCCGCTTCTGAGACCCGGATCGAACTTAGGTAGCCAGGTGCTGTTCTCGCAAAGGCAGAAAGTAGTCTTAACCTTAGCAACTGTTGGTT"}
-		m, _ := NewMegamashMap([]fasta.Record{{Sequence: oligo1, Identifier: "oligo1"}, {Sequence: oligo2, Identifier: "oligo2"}, {Sequence: oligo3, Identifier: "oligo3"}},
-			DefaultKmerSize, DefaultMinimalKmerCount, DefaultScoreThreshold)
+		m, _ := megamash.NewMegamashMap([]fasta.Record{{Sequence: oligo1, Identifier: "oligo1"}, {Sequence: oligo2, Identifier: "oligo2"}, {Sequence: oligo3, Identifier: "oligo3"}},
+			megamash.DefaultKmerSize, megamash.DefaultMinimalKmerCount, megamash.DefaultScoreThreshold)
 		for _, sample := range samples {
 			_ = m.Match(sample)
 		}
@@ -41,24 +42,24 @@ func BenchmarkMegamash(b *testing.B) {
 
 func TestMatchesConversion(t *testing.T) {
 	// Initial slice of Match structs
-	matches := []Match{
+	matches := []megamash.Match{
 		{"match1", 90.1},
 		{"match2", 85.5},
 	}
 	// Convert matches to JSON string
-	jsonStr, err := MatchesToJSON(matches)
+	jsonStr, err := megamash.MatchesToJSON(matches)
 	if err != nil {
 		t.Fatalf("MatchesToJSON failed with error: %v", err)
 	}
 
 	// Convert JSON string back to slice of Match structs
-	convertedMatches, err := JSONToMatches(jsonStr)
+	convertedMatches, err := megamash.JSONToMatches(jsonStr)
 	if err != nil {
 		t.Fatalf("JSONToMatches failed with error: %v", err)
 	}
 
 	// Convert the convertedMatches back to JSON to compare strings
-	convertedJSONStr, err := MatchesToJSON(convertedMatches)
+	convertedJSONStr, err := megamash.MatchesToJSON(convertedMatches)
 	if err != nil {
 		t.Fatalf("MatchesToJSON failed with error: %v", err)
 	}

lib/bio/fastq/fastq.go

@@ -16,6 +16,7 @@ import (
 	"errors"
 	"fmt"
 	"io"
+	"sort"
 	"strings"
 )
 
@@ -40,6 +41,17 @@ type Read struct {
 	Quality    string            `json:"quality"`
 }
 
+// DeepCopy deep copies a read. Used for when you want to modify optionals then
+// pipe elsewhere.
+func (read *Read) DeepCopy() Read {
+	newRead := Read{Identifier: read.Identifier, Sequence: read.Sequence, Quality: read.Quality}
+	newRead.Optionals = make(map[string]string)
+	for key, value := range read.Optionals {
+		newRead.Optionals[key] = value
+	}
+	return newRead
+}
+
 // Header is a blank struct, needed for compatibility with bio parsers. It contains nothing.
 type Header struct{}
 
@@ -161,7 +173,11 @@ func (parser *Parser) Next() (Read, error) {
 	if len(line) <= 1 { // newline delimiter - actually checking for empty line
 		return Read{}, fmt.Errorf("empty quality sequence for %q,  got to line %d: %w", seqIdentifier, parser.line, err)
 	}
-	quality = string(line[:len(line)-1])
+	if parser.atEOF {
+		quality = string(line)
+	} else {
+		quality = string(line[:len(line)-1])
+	}
 
 	// Parsing ended. Check for inconsistencies.
 	if lookingForIdentifier {
@@ -179,12 +195,6 @@ func (parser *Parser) Next() (Read, error) {
 	return fastq, nil
 }
 
-// Reset discards all data in buffer and resets state.
-func (parser *Parser) Reset(r io.Reader) {
-	parser.reader.Reset(r)
-	parser.line = 0
-}
-
 /******************************************************************************
 
 Start of  Write functions
@@ -200,8 +210,15 @@ func (read *Read) WriteTo(w io.Writer) (int64, error) {
 	if err != nil {
 		return writtenBytes, err
 	}
-	for key, val := range read.Optionals {
-		newWrittenBytes, err = fmt.Fprintf(w, " %s=%s", key, val)
+	keys := make([]string, len(read.Optionals))
+	i := 0
+	for key := range read.Optionals {
+		keys[i] = key
+		i++
+	}
+	sort.Strings(keys)
+	for _, key := range keys {
+		newWrittenBytes, err = fmt.Fprintf(w, " %s=%s", key, read.Optionals[key])
 		writtenBytes += int64(newWrittenBytes)
 		if err != nil {
 			return writtenBytes, err

lib/go.mod

@@ -4,5 +4,6 @@ go 1.22.0
 
 require (
 	github.com/google/go-cmp v0.6.0
+	github.com/koeng101/dnadesign/external v0.0.0-20240213205901-f4998ef84117
 	golang.org/x/sync v0.5.0
 )

lib/go.sum

@@ -1,4 +1,6 @@
 github.com/google/go-cmp v0.6.0 h1:ofyhxvXcZhMsU5ulbFiLKl/XBFqE1GSq7atu8tAmTRI=
 github.com/google/go-cmp v0.6.0/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY=
+github.com/koeng101/dnadesign/external v0.0.0-20240213205901-f4998ef84117 h1:MLWgADbigSsAmDP3yG93ESlN0Ek9QLtH5uHigmWVXwg=
+github.com/koeng101/dnadesign/external v0.0.0-20240213205901-f4998ef84117/go.mod h1:nb80z/jm5HMCxfNZ50cBJa5TffkXxpY9okvqnBj8RrM=
 golang.org/x/sync v0.5.0 h1:60k92dhOjHxJkrqnwsfl8KuaHbn/5dl0lUPUklKo3qE=
 golang.org/x/sync v0.5.0/go.mod h1:Czt+wKu1gCyEFDUtn0jG5QVvpJ6rzVqr5aXyt9drQfk=